eclipse ti inverted a1r laser scanning confocal microscope (Nikon)
Nikon is a verified supplier 
99
Structured Review
Nikon
eclipse ti inverted a1r laser scanning confocal microscope
Eclipse Ti Inverted A1r Laser Scanning Confocal Microscope, supplied by Nikon, used in various techniques. Bioz Stars score: 99/100, based on 59743 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/confocal+inverted+microscope/Objectives/pm41928034-196-7-6
Average 99 stars, based on 59743 article reviews
Eclipse Ti Inverted A1r Laser Scanning Confocal Microscope, supplied by Nikon, used in various techniques. Bioz Stars score: 99/100, based on 59743 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/confocal+inverted+microscope/Objectives/pm41928034-196-7-6
Average 99 stars, based on 59743 article reviews
eclipse ti inverted a1r laser scanning confocal microscope - by Bioz Stars,
2026-10
99/100 stars
Images
Related Articles
Inverted Microscopy:Article Title: The 8‐oxoguanine DNA glycosylase‐synaptotagmin 7 pathway increases extracellular vesicle release and promotes tumour metastasis during oxidative stress Article Snippet: The nucleus was stained with DAPI (BD5010, Bioworld, Nanjing, China). .. Image analysis was performed using Article Title: Stratified tissue biofabrication by rotational internal flow layer engineering. Article Snippet: .. Tubes were sectioned and imaged in the sagittal plane using a Nikon Article Title: Effects of crime scene contaminants on surface-enhanced Raman analysis of hair. Article Snippet: Hair evidence is one of the most commonly studied types of trace evidence in forensic crime scene analysis.. Once the hair has been collected from a crime scene, it is analyzed by a forensic expert to (i) determine the biological origin of hair and to (ii) identify the area of the body from which the hair originates [1].. Next, a patternrecognition process is employed to establish a connection between the hair found at a crime scene and hair of a suspect. Article Title: Decellularization of Rat Submandibular Gland for Salivary Gland Tissue-Engineering Applications Article Snippet: .. Finally, imaging was performed using a fluorescent Article Title: The ε-Isozyme of Protein Kinase C (PKCε) Is Impaired in ALS Motor Cortex and Its Pulse Activation by Bryostatin-1 Produces Long Term Survival in Degenerating SOD1-G93A Motor Neuron-like Cells. Article Snippet: .. Representative photomicrographs show panPKCε expressed in cortical neuronal cells (MAP2+ or NF-H+) examined under a Nikon Article Title: Decellularization of Rat Submandibular Gland for Salivary Gland Tissue-Engineering Applications. Article Snippet: .. Finally, imaging was performed using a fluorescent Article Title: The ε-Isozyme of Protein Kinase C (PKCε) Is Impaired in ALS Motor Cortex and Its Pulse Activation by Bryostatin-1 Produces Long Term Survival in Degenerating SOD1-G93A Motor Neuron-like Cells. Article Snippet: .. Slides were examined under a Nikon Imaging:Article Title: Stratified tissue biofabrication by rotational internal flow layer engineering. Article Snippet: .. Tubes were sectioned and imaged in the sagittal plane using a Nikon Article Title: Decellularization of Rat Submandibular Gland for Salivary Gland Tissue-Engineering Applications Article Snippet: .. Finally, imaging was performed using a fluorescent Article Title: Decellularization of Rat Submandibular Gland for Salivary Gland Tissue-Engineering Applications. Article Snippet: .. Finally, imaging was performed using a fluorescent other:Article Title: Decreased level of TREM like Transcript 1 (TLT-1) is associated with prematurity and promotes the in-utero inflammatory response to maternal lipopolysaccharide (LPS) exposure. Article Snippet: Gene Name Forward Primer Reverse Primer β2m Beta-2microglobulin ATGCTATCCAGAAAACCCCTCAAA CAGTTCAGTATGTTCGGCTTCCC Tgf-β Transforming growth factor beta CGCAACAACGCCATCTATGAG TGCTCCACACTTGATTTTAATCTCTGC Ifng Interferon gamma CCTCATGGCTGTTTCTGGCTGTTA CATTGAATGCTTGGCGCTGGACC Ifngr Interrferon gamma receptor CAGGTAAAGGTGTATTCGGGTTCC CCAGGCAGATACATCAGGATACATAAT IL10 Interleukin-10 TTACTGACTGGCATGAGGATCA GAAAGAAAGTCTTCACCTGGCTGA IL17 Interleukin-17 GACTCTCCACCGCAATGAAGACC CCCACACCCACCAGCATCT IL6 Interleukin-6 AGAAAGACAAAGCCAGAGTCCTTCAG GTCCTTAGCCACTCCTTCTGTGACT Ifnb Interferon beta TGTCCTCAACTGCTCTCCAC CCTGCAACCACCACTCATTC Mcp1 Monocyte chemoattractant protein-1 TGATCCCAATGAGTAGGCTGGAG TCCGCATAGGTGGTAACTTGT IL23a Interleukin 23 alpha GACCCACAAGGACTCAAGGACAAC TGGCTGGAGGAGTTGGCTGA Cxcl1/KC Chemokine (C-X-C) ligand 1 CATGGCTGGGATTCACCTCA TTACTTGGGGACACCTTTTAGCAT Gmcsf/Csf2 Granulocyte-Macrophage Colony Stimulating Factor CGTTGAATGAAGAGGTAGAAGTCG TCCGCATAGGTGGTAACTTGT IL1 Interleukin-1 TGCCACCTTTTGACAGTGATG TGATGTGCTGCTGCGAGATT completed with a Software:Article Title: Decellularization of Rat Submandibular Gland for Salivary Gland Tissue-Engineering Applications Article Snippet: .. Finally, imaging was performed using a fluorescent Article Title: Decellularization of Rat Submandibular Gland for Salivary Gland Tissue-Engineering Applications. Article Snippet: .. Finally, imaging was performed using a fluorescent |